Rhematoid ArthritisNCT07397741
Evaluation of CCR6 Gene Expression and Circulating CCL20 Levels as Potential Biomarkers in Rheumatoid Arthritis
An observational study of Rhematoid Arthritis, run by Sohag University.
Trial summary
Rheumatoid arthritis (RA) is characterized as a systemic auto immune disorder linked to a persistent inflammatory process that can harm both joints and extra articular organs. The upregulation of the CCR6/CCL20 axis in the synovial tissues and salivary glands (in cases of secondary Sjögren's syndrome) is considered to… Read more about this study
- Who is it for?
- Ages 18 to 60 yearsHealthy volunteers can take part
- Conditions the study is for
- Rhematoid Arthritis
- What is being tested?
- Gene expression by quantitative Real Time PCR
- How many people
- 60 participants
- Where
- No sites listed yet
- Study dates
- 1 Mar 2026to 1 Mar 2027
- Phase
- Observational
Key requirements
Who can take part, as listed by the sponsor. Only the study team can confirm whether you are eligible, so take this list to your doctor.
- Ages 18 to 60 years
- All sexes
- Healthy volunteers accepted
- Adult
Study population: Patients with Rheumatoid Arthritis aged from 18 years to 60 years, in Rheumatology and Rehabilitation department of Sohag University Hospital and healthy controls of matched age and sex
Who may be able to join
- Adults (18-60 years) diagnosed with RA according to the American College of Rheumatology/European League Against Rheumatism (ACR/EULAR) 2010 classification criteria for RA by an expert rheumatologist.
Who cannot join
- • Patients with co-existing infections or other autoimmune diseases.
Trial locations and contacts
No sites are listed yet. Contact the study team or a site near you to ask about taking part.
About this study
Rheumatoid arthritis (RA) is characterized as a systemic auto immune disorder linked to a persistent inflammatory process that can harm both joints and extra articular organs.
The upregulation of the CCR6/CCL20 axis in the synovial tissues and salivary glands (in cases of secondary Sjögren's syndrome) is considered to contribute to the recruitment of Th17 cells, which in turn enhances IL 17A production and promotes the inflammatory cycle.
Read the detailed description
Although the aetiology and progression of RA remain incompletely elucidated, various therapeutic modalities are accessible, significantly altering the prognosis of patients with the disease.
Various cell types are implicated in the pathophysiology of RA, including synovial fibroblasts, osteoclasts, immune associated T and B lymphocytes, and macrophages. The orchestration of these cells induces the release of diverse inflammatory mediators (cytokines and chemokines) that perpetuate the chronic inflammatory response of the disease. Chemokines and their receptors regulate lymphocyte recruitment to inflamed joints in RA. Cytokines, encompassing both pro inflammatory and anti-inflammatory types, are recognized for their essential involvement in the evolution of RA via inflammation and the degradation of articular cartilage.
The chemokine receptor (CCR)6 is a class A GPCR within the chemokine family, noted for its notable therapeutic promise in immunological research.
The sole chemokine ligand for CCR6 is chemokine ligand 20 (CCL20), which is also referred to as macrophage inflammatory protein (MIP) 3α, Exodus 1 and liver and activation regulated chemokine. In humans, it is expressed by neutrophils, Th17 cells and peripheral blood mononuclear cells. This axis has distinct functions in immunological homeostasis and activation.
CCL20 is one of the chemokines mainly produced by inflamed synovial cells in response to cytokines, including TNF-α (tumour necrosis factor-α), IL-1, IL-17, and IL-18.
Synovial T lymphocytes generate cytokines, such as TNFα, IFNγ and IL 17A. The production of pro inflammatory cytokines was originally ascribed to Th1 cells Subsequently, it was elucidated that IL 17A production among Th cells was confined to a distinct Th cell subpopulation, subsequently designated as Th17.
The interaction between CCR6 and CCL20 is critical, not only for the migration of Th17 cells, but also for their activation and differentiation. CCL20 has been shown to be involved in the differentiation of naive T cells into Th17 cells, thereby directly influencing IL 17A production in patients with RA.
- Conditions
- Rhematoid Arthritis
- Being tested
- Gene expression by quantitative Real Time PCR
- Keywords
- CCR6/CCL20 axis in Rheumatoid arthritis
What participants receive
What participants receive. In a randomised study each person is assigned to one group by chance.
Gene expression by quantitative Real Time PCRGenetic
Sample collection:
- 5 ml peripheral blood will be collected under sterile conditions. 1-Gene Expression Assay
- Total RNA Extraction
- cDNA Synthesis
- Gene Expression Analysis:
- Quantitative Real-Time PCR (qRT-PCR) for CCR6 gene expression using primer as follows: Forward primer (5'-3'): CCACAATGAGCGGGGAATCAATGAA Reverse primer (5'-3'): CAAATAGCCTGGAGAACTGCCTGAC
- Normalization using housekeeping gene (GAPDH) Forward primer (5'-3'): GAAACCTGCCAAGTATGATG Reverse primer (5'-3'): AGGAAATGAGCTTGACAAAG 2-Assesment of CCL20 plasma level
- Using Enzyme Linked Immunosorbent Assay kit (ELISA).
| Study group | Role | What they receive |
|---|---|---|
| Group I | Patients with Rheumatoid Arthritis Receives: Genetic: Gene expression by quantitative Real Time PCR | |
| Group II | apparently healthy controls with no chronic illness of matched age and sex Receives: Genetic: Gene expression by quantitative Real Time PCR |
What is being measured
The primary outcome is the main question the study is designed to answer.
assess expression of CCR6 gene in peripheral blood leukocytes of RA patients compared to healthy individuals
assessment of CCR6 gene expression level using quantitative real time PCR
Measured: within 3 days of samples collection
Secondary outcomes (1)
Measure the plasma levels of CCL20
Measurement of the plasma levels of CCL20 using enzyme-linked immunosorbent assay (ELISA)
Measured: within 3 days after samples collection
Timeline
From the start of the study to its completion; the mark is today. Estimated dates are the sponsor’s plan.
- First posted9 Feb 2026
- Study start1 Mar 2026 (estimated)
- Primary completion1 Feb 2027 (estimated)
- Study completion1 Mar 2027 (estimated)
Resources
- Official record on ClinicalTrials.govThe registry entry this page is built from, with its full change history.
- Publications (3)Papers the sponsor has linked to this study.
- Other trials for Rhematoid ArthritisStudies of the same condition, open and under way.
- What the trial phases meanHow a treatment moves from first tests in people to approval.
More details
For doctors and researchers: how the study is designed, who runs it, and its registry IDs.
Study design
- Study type
- Observational
- Observational model
- Case-control
- Time perspective
- Cross-sectional
- Enrolment
- 60 participants (estimated)
Sponsor and investigators
- Lead sponsor
- Sohag University
- Sponsor type
- University, hospital or other
- Responsible party
- Principal investigator, Salma Khalaf Abdelmageed, Sohag University
IDs, dates and publications
- ClinicalTrials.gov ID
- NCT07397741
- Sponsor's protocol ID
- Soh-Med-26-1-3MD
- Status last verified
- Feb 2026
- First submitted
- 30 Jan 2026
- Last updated
- 9 Feb 2026
- Results posted
- No
- Data monitoring committee
- No
- FDA-regulated drug
- No
- FDA-regulated device
- No
Publications
Conforti A, Di Cola I, Pavlych V, Ruscitti P, Berardicurti O, Ursini F, Giacomelli R, Cipriani P. Beyond the joints, the extra-articular manifestations in rheumatoid arthritis. Autoimmun Rev. 2021 Feb;20(2):102735. doi: 10.1016/j.autrev.2020.102735. Epub 2020 Dec 17.
PubMed 33346115Ciofani M, Madar A, Galan C, Sellars M, Mace K, Pauli F, Agarwal A, Huang W, Parkhurst CN, Muratet M, Newberry KM, Meadows S, Greenfield A, Yang Y, Jain P, Kirigin FK, Birchmeier C, Wagner EF, Murphy KM, Myers RM, Bonneau R, Littman DR. A validated regulatory network for Th17 cell specification. Cell. 2012 Oct 12;151(2):289-303. doi: 10.1016/j.cell.2012.09.016. Epub 2012 Sep 25.
PubMed 230217771- Al Obaidi MJ and Al Ghurabi BH: Potential role of NLRP3 inflammasome activation in the pathogenesis of periodontitis patients with type 2 diabetes mellitus. J Med Chem Sci 6: 522-531, 2023.